Introduction

Pain is a complex experience that incorporates sensory and affective dimensions. There is a complex relationship between gonadal hormones and brain function in women, altering pain perception (Nasser and Afify 2019). More women than men seek treatment for orofacial pain, indicating that women suffer from a more serious pathological condition of orofacial pain than men (Xue et al. 2018). Although pain affects > 25% of the world’s population, it is generally more frequent in women (Osborne and Davis 2022). Possible explanations for disparities between men and women range from biological (genetic or hormonal differences) to psychosocial (experiential and sociocultural factors) and emotional components (Osborne and Davis 2022).

Efficient pain management is a crucial but challenging task given that pain is a symptom in 90% of human diseases, various pain modulators have been identified, yet analgesic drugs have limited effectiveness and severe adverse effects like opioid addiction (Laev and Salakhutdinov 2021).

Metformin is a biguanide used worldwide in the treatment of type 2 diabetes (Flory and Lipska 2019). It has been used in drug repositioning studies that demonstrate its action in the treatment of various types of cancer (Qian et al. 2021), cardiovascular diseases (Bu et al. 2022), neuropathic pain (Baeza-Flores et al. 2020; Cao et al. 2021), osteoarthritis (Song et al. 2022), aging delay (Podhorecka et al. 2017), in addition to modulating the microbiota promoting metabolic health (Pryor and Cabreiro 2015).

Furthermore, metformin has demonstrated analgesic effects in neuropathic pain (Hacimuftuoglu et al. 2020), inflammatory pain (Russe et al. 2013), and visceral pain (Nozu et al. 2019) and this effect seems to be related to a downregulation of the TRPV1 channel (Qian et al. 2021), however, there seems to be a sex-related difference in response (de Angelis et al. 2022).

The present study aims to demonstrate whether there is sexual dimorphism in the orofacial antinociceptive effect of metformin.

Materials and methods

Drugs and reagents

The following drugs and reagents were used in the study: metformin hydrochloride (Merck) was dissolved in distilled water; saline solution (0.9%; Arboreto®, Brazil); capsaicin, cinnamaldehyde, capsazepine and HC-030031 (Sigma-Aldrich, USA); formaldehyde (Vetec®, Brazil); ketamine and xylazine (Syntec®, Brazil); TRIzol© Reagent, DNase I, SuperScript III enzyme and PCR Master Mix (Thermo Scientific, USA). In addition, phosphate-buffered saline (PBS) was prepared using 0.15 M NaCl (Cromoline®, Brazil), 0.01 M NaH₂PO₄ (Vetec®, Brazil) and NaCOH3 (Vetec®, Brazil; quantum sufficit to pH 7.2).

Animals

In the experiments, Swiss mice (20–30 g) and Wistar rats (200–250 g), both sexes, from the Animal Facility of the Experimental Biology Center (NUBEX) of the University of Fortaleza, Brazil. The specific-pathogen-free animals were housed in appropriate cages (IVC cages, Techniplast®) and kept at a room temperature of 22–24 °C on a 12:12 h light: dark cycle. They received standard feed (Purina, São Paulo, Brazil) and water ad libitum. All protocols were in strict compliance with the standards established by Brazil’s National Council on Animal Experimentation Control and received approval from the Committee on Animal Research and Ethics of UNIFOR (#8811280818).

Treatments

The animals (n = 6 / group) were divided into the following groups:

1 – Female control (Distilled water p.o. (per os); vehicle);

2 – Male control (Distilled water p.o.; vehicle);

3 – Female treated with metformin (125 and 250 mg/kg p.o.);

4 – Male treated with metformin (125 and 250 mg/kg p.o.);

5 – Female Sham (0.9% NaCl, p.o.);

6 – Male Sham (0.9% NaCl, p.o.).

Sham groups (n = 6/each) were incorporated into the formalin temporomandibular joint (TMJ) nociception and infraorbital nerve transection experiments.

The chosen dose was 250 mg/kg according to Pereira et al. (2019). All groups were tested with blind design.

Antinociceptive activity

Cinnamaldehyde-induced orofacial nociception

Female and male mice (n = 6/group) were treated with metformin (125 and 250 mg/Kg; p.o.) or vehicle (10 mL/Kg; p.o.), 60 min before cinnamaldehyde [TRPA1-specific agonist, 0.66 µM, 20 µL (Nomura et al. 2013)] (Fig. 1a) injection with a 27-gauge needle in the right upper lip (paranasal area). Nociception was quantified by the time the animal spent rubbing the injection site with the fore or hind paw from 0 to 5 min after cinnamaldehyde injection.

Fig. 1
figure 1

Flowchart of animal experiments. The time ranges for some of the behavioral assessments reflect the different behavioral testing periods used in the different models. (a to d) Acute orofacial pain models. (e) Chronic pain model following infraorbital nerve transection (IONX). Metformin was administered for all 21 postoperative days

Full size image

In subsequent experiments, different groups of mice (n = 6/each) were pretreated by subcutaneous injection into the upper lip (perinasal area) of the antagonist HC-030031 [TRPA1 antagonist (Eid et al. 2008); 20 µL, 0.1 mg/mL] 15 min prior to administration of metformin (125 mg/Kg; p.o.), (Fig. 1b) to check for its possible effects on TRPA1 channels.

Capsaicin-induced orofacial nociception

Female and male mice (n = 6/group) were treated with metformin (125 and 250 mg/Kg; p.o.) or vehicle (10 mL/Kg; p.o.), 60 min before capsaicin [TRPV1-specific agonist, 2.5 µg, 20 µL (dissolved in ethanol, PBS, and distilled water in a 1:1:8 ratio) (Pelisser et al. 2002)] (Fig. 1a) injection with a 27-gauge needle in the right upper lip (paranasal area). Nociception was quantified by the time the animal spent rubbing the injection site with the fore or hind paw from 10 to 20 min after capsaicin injection.

In subsequent experiments, mice (n = 6/group) were pretreated by subcutaneous injection into the upper lip (perinasal area) of the antagonist capsazepine [competitive TRPV1 antagonist (Ducrocq et al. 2019); 20 µL, 30 nM], 15 min prior to administration of metformin (125 mg/Kg; p.o.) (Fig. 1c) to check for its possible effects on the TRPV1 channel.

Formalin temporomandibular joint (TMJ) nociception

Female and male rats (n = 6/group) were individually acclimated in a glass test chamber (30 × 30 × 30 cm) for 30 min to minimize stress. The animals were pre-treated (10 mL/kg) with vehicle or metformin (250 mg/kg) and 60 min later, 50 µL of 2.0% formalin was injected into the left TMJ by a Hamilton syringe and a 30-gauge needle (Fig. 1d). The sham groups (n = 6/each) received 0.9% NaCl (50 µL; Roveroni et al. 2001).

Animals were individually returned to the test chamber to quantify nociception as asymmetric rubbing of the orofacial region with the anterior part of the ipsilateral paw - or hind paw - and head jerking (intermittent and reflexive head shaking) and chewing. The time the rat spent rubbing the orofacial region was recorded 12 times at 3-min intervals.

Assessment of mechanical sensitivity after infraorbital nerve transection

Female and male rats (n = 6/group) were anesthetized with ketamine (100 mg/kg; intraperitoneal) and xylazine (10 mg/kg; intraperitoneal) to expose the left infraorbital nerve (ION) as it entered the infraorbital foramen through an oral infraorbital incision (2 mm) in the oral mucosa of the left fronto-lateral maxillary vestibule. The ION was lifted from the jawbone and cut (IONX) without damaging adjacent nerves and vessels. Subsequently, the animals were returned to the cages and fed with puree and feed. The animals were monitored daily postoperatively (Santos et al. 2022).

Rats were accustomed, trained and tested for facial mechanical sensitivity one day before nerve transection (baseline) and on postoperative days 1, 3, 5, 7, 10, 14 and 21, as previously described (Kumar, 2013; De Oliveira et al. 2020). Female and male rats were divided into following groups: metformin (250 mg/Kg; p.o.) was administered for all 21 postoperative days.

(Fig. 1e); vehicle; sham-operated animals (n = 6/each group). The mechanical sensitivity of the left whisker skin was evaluated using Von Frey electronics. The head withdrawal threshold to mechanical stimulation of the mustache skin was defined as the minimum force necessary to evoke an escape.

RT-PCR

Samples of the nerve were taken after transection of the infraorbital nerve ION was removed from the jaw and cut (IONX). Females were chosen because they had a better result in IONX. RT-PCR was used to see if metformin interferes with gene expression of TRPV1 channels. Total RNA from infraorbital nerve samples was extracted using the TRIzol© Reagent (Thermo Scientific, USA) according to the manufacturer’s instructions. Samples were treated with DNase I (Thermo Scientific, USA) and reverse transcribed using the SuperScript III enzyme (Thermo Scientific, USA) and oligo(dT) primers. Specific primers for the TRPV1 gene (Trpv1-F 5′ CCCGGAAGACAGATAGCCTGA 3′ and Trpv1-R 5′ TTCAATGGCAATGTGTAATGCTG 3′) were used for amplifications (Primer Bank, Harvard Medical School). The Gapdh gene was chosen as endogenous control, and specific primers (Gapdh-F 5’ GTCGTGGAGTCTACTGGTGTC 3’ and Gapdh-R 5’ CTGTGGTCATGAGCCCTTCC 3’) were designed using the Primer BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast). Amplifications were conducted in a StepOne µM of each primer, 1X Power SYBR Green PCR Master Mix (ThermoµL of cDNA. Reactions were incubated at 95 °C for 10 min, followed by 45 cycles of 95 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s followed by a melting curve. Non-template controls were performed for each primer. Data were normalized using the 2-∆∆CT methodology (Livak and Schmittgen 2001).

Molecular docking study – TRPV1 and TRPA1

Molecular docking was used to investigate the possible interaction of the TRPV1 and TRPA1 channels with metformin. The docking was done from the three-dimensional structure of the TRPV1 and TRPA1 receptor, which is an ion channel whose three-dimensional structure was experimentally determined by cryo-electron microscopy (PDB ID: 3J5P and 3J9P, respectively). For fitting, a Metformin molecule (PUBCHEM CID: 4091) was rotated across the entire area of the receptor, excluding water molecules, and exploring the entire surface of TRPV1 and TRPA1. Obtaining clusters with high interaction energy was the determining factor of the interaction site. For the experiment, the HEX 8.0.0 software was used, which performs this sorting automatically (Macindoe et al. 2010). The parameters used for the docking process were: “Correlation type – Shape only, Calculation Device- CPU, Number of Solutions − 100, FFT Mode − 3D fast lite, Grid Dimension–0.6, Receiver Range-180 Receiver, Linker Range − 180, Torque Range − 360, Distance Range – 40”.

Statistical analyses

The results are presented as mean ± S.E.M. values of each group of 6 animals. Statistical analysis was carried out using one-way of variance (ANOVA), followed by Tukey or Bonferroni post-hoc tests for multiple comparisons. P-values less than 0.05 (p < 0.05) were considered indicative of statistical significance.

RESULTS

Orofacial antinociceptive effect of metformin

Pre-treatment with metformin (125 and 250 mg/Kg) in female and male mice was associated with a reduction in the face rubbing induced by cinnamaldehyde and capsaicin when compared with vehicle control (p < 0.0001 vs control; Table 1). There was only a difference between the control F and control M groups (a. p < 0.001 control F vs. control M).

Table 1 Effect of metformin on cinnamaldehyde and capsaicin nociception in mice
Full size table

Pretreatments with HC-030031 and capsazepine abolished the effect (p < 0.0001 vs. 125 mg/kg metformin; Fig.2) the decrease in face rubbing induced by metformin (125 mg/Kg).

Fig. 2
figure 2

Effect of HC-030031 (HC; left panel) and capsazepine (Capz; right panel) on the antinociceptive effect of metformin (Met; 125 mg/Kg) in the orofacial nociception models induced by cinnamaldehyde and capsaicin in mice. Each column represents the mean ± S.E.M (n = 6/group). Tukey’s test (****p < 0.0001 vs. control and a ****p < 0.0001 vs. metformin 125 and vs. HC or Capz)

Full size image

The injection of formalin into the temporomandibular junction induced the nociceptive behaviors of the face rubbing, head flinching and chewing. As shown in Fig. 3, metformin (250 mg/Kg) reduced face rubbing in male and female rats (p < 0.001 and p < 0.001 vs. control, respectively), head flinching (p < 0.0001 vs. control), chewing (p < 0.001 – female and p < 0.01 - male vs. control) and the sham group showed differences in all parameters compared to the control group (p < 0.0001 control F and control M vs. sham F and sham M), behaviors in the TMJ formalin test.

Fig. 3
figure 3

Effect of metformin (250 mg/Kg) on nociception induced by formalin injection into the temporomandibular joint in rats. Each column represents the mean ± S.E.M (n = 6/group) of the time spent in face rubbing (A) or time spent in head flinching (B) and chewing (C). One-way ANOVA with post-hoc Tukey’s test (**p < 0.01 and ****p < 0.0001 vs. control), head flinching (B) (a**p < 0.01 control F vs. control M) and (b**p < 0.01 met F vs. met M). F = female; M = male; Met = metformin

Full size image

The infraorbital nerve transection produced sustained changes in sensory processing, resulting in transient hypersensitivity to mechanical stimulation in the area innervated by the injured ION from the third postoperative day in females (p < 0.0001 vs. control) and from the fourteen postoperative day in males (p < 0.0001 vs. control). The female rats treated with metformin (250 mg/kg) showed decrease in the face-rubbing behavior from the third postoperative day (p < 0.0001 vs. control) to the twenty one postoperative day (p < 0.01 vs. control), while the group of male rats treated with metformin (250 mg/kg) showed decrease in the behavior of rubbing the face from the fourteen postoperative day (p < 0.0001 vs. control) to the twenty one postoperative day (p < 0.05 vs. control) (Fig. 4). The sham female group showed a difference (p < 0.0001) from the first to the tenth day, on the fourteenth day (p < 0.05) and on the twenty-first day (p < 0.001) vs. control female group. Sham male group showed a difference (p < 0.0001) from the first to the twenty one postoperative day.

Fig. 4
figure 4

Time course of effect of metformin (250 mg/Kg) on neuropathic nociception induced by infraorbital nerve transection in rats. PO = Postoperatively. Groups female (A) and Groups male (B). Two-way ANOVA with post-hoc Bonferroni correction (*p < 0.05, **p < 0.01, ****p < 0.0001 vs. control). Metformin and vehicle (control) were administered by gavage. Data are expressed as the mean ± S.E.M. (n = 6/group) and compared to the control group. F = female; M = male

Full size image

Gene expression

In the analysis of the TRPV1 gene expression in the trigeminal nerve of female rats, as it presented better results compared to males in IONX. collected after 21 days of infraorbital nerve transection, a reduced expression of the TRPV1 channels expression was observed in the metformin treated group (*p < 0.05), when compared to the control group (Fig. 5).

Fig. 5
figure 5

TRPV1 expression after nociceptive stimulus in mouse trigeminal ganglion is significantly reduced after metformin treatment. TRPV1 relative expression was evaluated and data normalized against Gapdh. (*p < 0.05 vs. control). Met = 250 mg/kg metformin

Full size image

Molecular docking findings

The most energetic clusters promote 8 overlaps in the same site, which is the center of the molecule, responsible for the passage of ions, which suggests high specificity of metformin, in a three-dimensional domain that can physically block the passage of ions and channel function. Metformin efficiently interacted with 4 amino acid residues in the center of the channel (Ile679, Ile679b, Ala680, Met682), performing 5 chemical bonds, ranging from 2.8 to 3.3 angstroms, which can modify the biological function of the channel TRPV1 by impeding the passage of ions, generating physical and spatial blockade (Fig. 6).

Fig. 6
figure 6

Three-dimensional structure of the TRPV1 channel with enlargement of the structural region responsible for the passage of ions, with its opening physically blocked by the most energetic cluster of metformin (blue sticks). The image shows the space occupied by the molecule in the complex formed, showing blockade by steric hindrance of approximately 50% of the passage of ions, with high reproducibility and stability: complexation with the TRPV1 channel through the recruitment of 4 amino acid residues (Ile679, Ile679b, Ala680, Met682), performing 5 chemical bonds (2.8 to 3.3 angstroms)

Full size image

Regarding the more stable complex (metformin with TRPV1), it was possible to observe that many reactive ends of metformin were stabilized by chemical bonds, through hydrogen bonds, hydrophobic interactions and van der Waals forces, and that there are no steric impediments in the structural conformation of the binding site, fitting the molecule into a “structural pocket” on the surface of the channel, in its central region.

The TRPA1 receptor interacts with the ligand, with bonds ranging from 2.7 to 3.7 angstroms, and that some amino acids of the receptor provide stable binding of the ligand, with 4 chemical bonds (hydrogen bonds and van der Waals forces), guaranteeing the biological action suggested by the in vivo experiment. The most strongly interacting amino acids are: Ile695, Lys969, His970, Leu973, Asp1037, Lys1038 and Ser1039. The hydrogen bonds that stabilize the formation of the complex are evidenced by the residues of Ile695, Leu973, Lys969 and Lys1038. (Fig. 7).

Fig. 7
figure 7

Intracellular view of the TRPA1 channel (green cartoon) and the 10 clusters with the highest complexation energy of metformin (colored sticks), showing the unimpeded passage of ions (central region) and the spatial and energetic compatibility of metformin (blue stick) in a region rich in alpha-helix structures with chemical bonds between metformin and TRPA1 receptor amino acids (2.7 to 3.7 angstroms)

Full size image

Metformin is a bioactive molecule, with several reactive ends capable of binding to ionized amino acids, preferably apolar and unimpeded, of both channels (TRPV1 and TRPA1). The energy loss observed after the complexation of the 10 most energetic clusters of metformin promoted similar energies in both receptors, with variations of a maximum of 3.3% (Table 2).

Table 2 Binding energies of metformin with TRPV1 and TRPA1 receptors (Etotal: Kcal/mol)
Full size table

Molecular docking simulation was performed to identify the best interaction mechanism and the molecular bases of the complex formed between metformin and the receptors: TRPA1 and TRPV1. Thus, as shown in Fig. 8, the molecular docking of the receptors with their classical ligands (standardized drugs) demonstrates that both capsazepine (TRPV1 antagonist) and HC-030031 (TRPA1 antagonist) are ligands with affinity for the center of the channel, and because they are ion channels, blocking the passage of ions is one of the evidences of greater antagonistic action, which occurs perfectly in the TRPV1-Metformin complex, but does not happen in the TRPA1-Metformin complex.

Fig. 8
figure 8

Molecular docking simulation showing the interaction site of the antagonists and the binding site identified in the metformin study: (A) TRPA1-HC030031 complex; (B) TRPA1-Metformin complex; (C) TRPV1-Capsazepine complex; (D) TRPV1-Metformin complex

Full size image

Discussion

This study evaluated the difference between sexes in the orofacial antinociceptive effect of metformin and transient receptor potential channel involvement. The study provided novel findings that pre-treatment with metformin reduced the nociceptive behavior induced by cinnamaldehyde and capsaicin in mouse female and male was associated with a significant reduction in the face rubbing. This result supports the idea that metformin acts on the TRPA1 and TRPV1 receptors. It was observed that the effect of metformin was abolished by pretreatment with the TRPA1 channel antagonist (HC-030031) (Souza et al. 2020) and TRPV1 channel antagonist (capsazepine) (Zarei et al. 2022), suggesting a specific action of metformin on ankyrin and vanilloid channels.

If capsazepine and the other competitive antagonist do not bind completely or do not affect all TRPV1 subtypes, such as TRPV1b, capsaicin can still bind and activate these subtypes that are not completely blocked (Schumacher and Eilers 2010; Luu et al. 2021). Capsaicin may cause pain in the presence of competitive antagonists such as capsazepine, especially if these antagonists do not completely block all TRPV1 subtypes, such as TRPV1b. This is because capsaicin may bind to receptor subtypes that are not fully blocked or if the antagonism is not complete, allowing capsaicin to still activate the receptor and cause pain (Vos et al. 2006; Lu et al. 2005).

In the present study, we consider the possibility that, while capsazepine acted as a selective antagonist of the TRPV1 channel, metformin exerted its action not only on TRPV1 to reduce TRPV1 channel activity, but also blocked the TRPV1b isoform variant. This blockade reduced the inhibition exerted by TRPV1b on TRPV1, thus allowing the TRPV1 channel to remain functional and susceptible to activation by capsaicin, even in the concomitant presence of capsazepine and metformin, resulting in a nociceptive response. Therefore, further studies are needed to analyze the mechanisms by which TRPV1 channels may contribute to the antinociceptive effects of metformin.

TRPA1 variants such as TRPA1b provide an additional level of regulation in the activity of TRPA1 channels, allowing a more precise adjustment of the sensitivity to nociceptive and inflammatory stimuli and the structural diversity of these isoforms positions TRPA1 as a promising therapeutic target, enabling the development of specific drugs for the treatment of conditions related to pain and inflammation (Tominaga 2016).

TRPA1b has a distinct modulatory function. Studies suggest that it may inhibit the activity of TRPA1a, that is, TRPA1b may act as a negative regulator of the function of the original TRPA1 channel, influencing the sensitivity of the receptor to stimuli (Tominaga 2016; Lam et al. 2017).

Metformin may be acting on some variant of the TRPA1 channel such as TRPA1b. In the TRPA1 channel, metformin may have also acted through an allosteric ligand on the TRPA1 channel that can be activated or modulated indirectly by other channels, proteins or cellular conditions, such as changes in membrane potential. Therefore, additional studies are needed to analyze the mechanisms by which TRPA1 channels may contribute to the antinociceptive effects of metformin.

Our findings are consistent with these various actions in showing that lip or TMJ injections of formalin (Roveroni et al. 2001), cinnamaldehyde (Nomura et al. 2013) or capsaicin (Pelisser et al. 2002) induced nociceptive behaviors, while oral administration of metformin in female and male rats or mice induced antinociceptive effects on these nociceptive behaviors on both sexes.

Temporomandibular disorders (TMDs) are musculoskeletal pain conditions characterized by discomfort in the temporomandibular joint (TMJ) and/or masticatory muscles, and are the most common cause of orofacial pain. Formalin (Roveroni et al. 2001) is frequently used to activate nociceptors in various animal models. In this study, we observed that formalin-induced nociception in the TMJ was effectively prevented by metformin administration in both sexes.

The animals that received transection of the infraorbital nerve (IONX) were found to have prolonged facial hyperalgesia that lasted for many days after IONX, consistent with earlier findings in this trigeminal neuropathic pain model (Kumar et al. 2013; Santos et al. 2022).

Metformin was administered for all 21 postoperative days. In female rats, a decrease in face-rubbing behavior was observed from the third to the twenty-first postoperative day after infraorbital nerve transection, indicating decreased thermal and mechanical hypersensitivity during this period. In contrast, male rats showed this lesser hypersensitivity only on the fourteenth day, which persisted until the last day of the experiment, 21 days after the operation. Furthermore, in the case of neuropathic pain, females exhibited faster, and better results compared to males. The sex-related difference in pain perception may be amplified by the location of pain in different body parts, particularly in craniofacial pain, which is more common in women (Fejes-szabó et al. 2018). Also, more women than men suffer from trigeminal neuralgia (Kilgore et al. 2023). Metformin promotes orofacial antinociception in both sexes in acute nociception and is more effective in chronic pain in females than in males.

Sex hormones appear to play a decisive role in interfering with sex differences in pain perception, with estrogen appearing as a trigger in pain behavior in female rats during periods of inflammatory pain, low levels of estrogen can potentiate orofacial pain (Robinson et al. 2020). It was previously shown that metformin increases the size of the termed neural precursor cells pool in adult females, but not males, and promotes cognitive recovery in a model of brain injury in females, but not males (Ruddy et al. 2019).

In the analysis of the expression of the TRPV1 gene in the trigeminal nerve of rats, a reduced expression of the TRPV1 channels was demonstrated in the group treated with metformin, when compared to the control group. This result suggests that TRPV1 might be involved in the orofacial antinociceptive effect of metformin (Luo et al. 2021). The complex formed between Metformin and the TRPV1 channel is the most promising in relation to antagonistic action. According to molecular docking, it’s the best interaction, which indicates greater relevance for gene expression studies.

Docking revealed, among 5,000 fitting possibilities, the 10 most energetic in the association of Metformin with the TRPV1 and TRPA1 channels, which provides information on affinity for the receptor and specificity for the site of interaction. Regarding affinity and specificity, it is possible to suggest that the reproducibility of clusters in the same region may indicate the specificity of the ligand at that site. This evidence was most efficiently observed in the Metformin-TRPV1 complex, which showed overlap in 9 of the 10 most energetic clusters.

To justify this interaction, it is worth mentioning that Metformin has a high molecular weight (129.16 g/mol), which increases the possibility of interaction with “structural pockets” of the TRPV1 channel. Thus, metformin is a bioactive molecule, with several reactive ends capable of binding to ionized amino acids, preferably non-polar and unimpeded, of the TRPV1 channel. Based on this, the structure of the channel, when associated with Metformin, showed relevant energy stabilization (-150.15 kcal/mol), which suggests a decrease in its intrinsic vibration and its biological role. The energy loss observed after the complexation of the most energetic clusters of metformin promoted similar energies in both receptors, with variations of a maximum of 3.3% (Forteath et al. 2023).

Regarding possible steric and spatial impediments caused by complexations, it was demonstrated that there are no impediments in any of the TRPA1-Metformin complexes obtained. The ion passage channel of the TRPA1 receptor was compromised, which suggests that metformin acts as an antagonist by stabilizing and complexing amino acid residues of the extracellular domain, changing the reactivity and intrinsic charges that sustain the passage of ions. It can be suggested that the channel loses essential structural charges for its function and for its molecular dynamics.

To justify the competitive antagonist action, it is necessary to analyze the binding site of the classical ligands of each receptor and verify whether metformin has specificity and affinity for the same interaction site. The affinity of the HC-030031 ligand is in the center of the TRPA1 channel, blocking the passage of ions and promoting an antagonist effect due to this spatial blockage (binding energy of -307.38 kcal/mol), which does not occur in the TRPA1-Metformin complex with reduced channel activity due to the modification of its three-dimensional conformation and reduction of its flexibility (binding energy of only − 155.33 kcal/mol) when binding close to the center, but which does not suggest a competitive antagonist mechanism for the same site as HC-030031. In the analysis of the TRPV1-Capsazepine complex, it is possible to observe affinity and specificity for the center of the channel, which also occurs in the TRPV1-Metformin complex, which presents affinity for the same site (center of the channel), suggesting the molecular basis of a competitive antagonist action.

Animal research also shows the presence of sexual dimorphism and the modulating effect of sex hormones on orofacial pain (Mason et al. 2022). To maximize the chances of success in treating orofacial pain in humans, it is scientifically rational and strategic to confirm the efficacy of drugs in various animal models and modalities, considering that the vast majority of tests are performed on young adult male rodents (Mogil 2020). Previous evidence indicates that pain mechanisms and analgesic responses may differ according to sex, highlighting the importance of including female rodents in the models (Mauvais-Jarvis et al. 2020). Incorporating a sex and gender perspective into the investigation of orofacial pain can substantially improve the understanding of the underlying biological and physiological factors, in addition to directly impacting the development of more effective diagnoses and treatments (Baggio et al. 2023).

In brain activity, women showed increased power of the alpha frequency peak related to neuropathic pain in the ascending nociceptive pathway, salience network and default mode network, while men with neuropathic pain showed increased power of the alpha frequency peak restricted to the ascending nociceptive pathway (Fauchon et al. 2022).

Studies prove the protective effect of metformin on neuroinflammation and sensory and locomotor complications in spinal injuries (Afshari et al. 2018) and on chronic peripheral neuropathy induced by oxaliplatin in chemotherapy in patients with colorectal cancer (El-fatatry et al. 2018). This effect appears to be associated with the fact that metformin activates adenosine monophosphate-activated protein kinase (AMPK) (Ge et al. 2018), Adenosine monophosphate-activated protein kinase (AMPK) has recently emerged as a promising new therapeutic target for the treatment of pain and is a therapeutic target for novel analgesics (Rey and Tamargo-Gómez 2023). Recent literature has explored metformin as a new option for pain management expanding its potential beyond glycemic control to pain treatment (Li et al. 2020; Na et al. 2021; Baeza-Flores et al. 2020). The orofacial antinociceptive effect of metformin, as well as the sexual dimorphism in relation to this action, were studied for the first time, these are all potential sites where metformin may be acting and future studies are needed to determine its site(s) of action and other features of its mechanisms in modulating orofacial pain.

CONCLUSION

Metformin promotes orofacial antinociception in both sexes in acute pain through TRPV1 and TRPA1 channels and better in females chronic pain states through TRPV1 channels. These preclinical findings point to a potential repositioning of metformin as an analgesic agent in acute and chronic orofacial pain states.